Transcript: Mouse XM_017317119.1

PREDICTED: Mus musculus leucine-zipper-like transcriptional regulator, 1 (Lztr1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lztr1 (66863)
Length:
3494
CDS:
1149..2954

Additional Resources:

NCBI RefSeq record:
XM_017317119.1
NBCI Gene record:
Lztr1 (66863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103741 CCGGGATAAGATGTTCGTGTT pLKO.1 1139 5UTR 100% 4.050 5.670 N Lztr1 n/a
2 TRCN0000287309 CCGGGATAAGATGTTCGTGTT pLKO_005 1139 5UTR 100% 4.050 5.670 N Lztr1 n/a
3 TRCN0000103742 CCCGTACTATTACGGCTTCTA pLKO.1 2666 CDS 100% 0.495 0.693 N Lztr1 n/a
4 TRCN0000287311 CCCGTACTATTACGGCTTCTA pLKO_005 2666 CDS 100% 0.495 0.693 N Lztr1 n/a
5 TRCN0000294756 GTGCACACTGCACGAAGATTA pLKO_005 1709 CDS 100% 13.200 9.240 N Lztr1 n/a
6 TRCN0000103744 CCCAATGAGTTGCACTGCTAT pLKO.1 1353 CDS 100% 4.950 3.465 N Lztr1 n/a
7 TRCN0000287240 CCCAATGAGTTGCACTGCTAT pLKO_005 1353 CDS 100% 4.950 3.465 N Lztr1 n/a
8 TRCN0000103740 GCCTCCAGATAGGTACAGATA pLKO.1 3335 3UTR 100% 4.950 3.465 N Lztr1 n/a
9 TRCN0000287310 GCCTCCAGATAGGTACAGATA pLKO_005 3335 3UTR 100% 4.950 3.465 N Lztr1 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 536 5UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11260 pDONR223 100% 79.3% 86.5% None (many diffs) n/a
2 ccsbBroad304_11260 pLX_304 0% 79.3% 86.5% V5 (many diffs) n/a
3 TRCN0000466736 TGGAATTAGCTCCACCGTGTACTT pLX_317 22.3% 79.3% 86.5% V5 (many diffs) n/a
Download CSV