Transcript: Mouse XM_017317293.1

PREDICTED: Mus musculus notch 3 (Notch3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Notch3 (18131)
Length:
8096
CDS:
104..7096

Additional Resources:

NCBI RefSeq record:
XM_017317293.1
NBCI Gene record:
Notch3 (18131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075569 CGTGTGTAGACGGTGTCAATA pLKO.1 855 CDS 100% 13.200 18.480 N Notch3 n/a
2 TRCN0000301344 CGTGTGTAGACGGTGTCAATA pLKO_005 855 CDS 100% 13.200 18.480 N Notch3 n/a
3 TRCN0000304272 CCACGTGTCTTGACCGAATTG pLKO_005 1437 CDS 100% 10.800 15.120 N Notch3 n/a
4 TRCN0000310868 CGTGATGGCATCAACCGTTAT pLKO_005 2009 CDS 100% 10.800 15.120 N Notch3 n/a
5 TRCN0000075568 GCATTCCAGATAAGACGTGTA pLKO.1 7732 3UTR 100% 4.050 5.670 N Notch3 n/a
6 TRCN0000075572 GTGACAGTTGTGAGGATAATA pLKO.1 3453 CDS 100% 15.000 12.000 N Notch3 n/a
7 TRCN0000304271 TCTGACAAGAGTGAGTTATTA pLKO_005 7387 3UTR 100% 15.000 10.500 N Notch3 n/a
8 TRCN0000075571 CCGGGAGATCACAGATCACTT pLKO.1 6133 CDS 100% 4.950 3.465 N Notch3 n/a
9 TRCN0000075570 GTGTGAATACACAGGGCTCAT pLKO.1 1329 CDS 100% 4.050 2.835 N Notch3 n/a
10 TRCN0000304273 TCACCCTCAGGAGCTACTAAC pLKO_005 4094 CDS 100% 10.800 6.480 N Notch3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489840 GCGCTGGCTCACACTAGACAAAAG pLX_317 3.8% 83.9% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV