Transcript: Mouse XM_017317397.1

PREDICTED: Mus musculus phosphatidylinositol-4-phosphate 5-kinase-like 1 (Pip5kl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pip5kl1 (227733)
Length:
2256
CDS:
85..2016

Additional Resources:

NCBI RefSeq record:
XM_017317397.1
NBCI Gene record:
Pip5kl1 (227733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025102 AGCACATTCAAGTCCATACAA pLKO.1 1738 CDS 100% 5.625 7.875 N Pip5kl1 n/a
2 TRCN0000025099 GCTGCATAGAATGACACGAAT pLKO.1 984 CDS 100% 4.950 6.930 N Pip5kl1 n/a
3 TRCN0000025100 GTGTGGAAGATGGTACGCTAT pLKO.1 1915 CDS 100% 4.050 5.670 N Pip5kl1 n/a
4 TRCN0000362177 TGGATATGACTACCGTGTATG pLKO_005 1871 CDS 100% 10.800 8.640 N Pip5kl1 n/a
5 TRCN0000362176 ACATCAAGGGCTGCAACATAA pLKO_005 1490 CDS 100% 13.200 9.240 N Pip5kl1 n/a
6 TRCN0000362097 TCTACCCTACCAGCCGCATTT pLKO_005 1457 CDS 100% 10.800 7.560 N Pip5kl1 n/a
7 TRCN0000052540 GTGCTGAAGGACCTCAACTTT pLKO.1 1555 CDS 100% 5.625 3.938 N PIP5KL1 n/a
8 TRCN0000025103 CCTACCTTCAATTCTTCAGCA pLKO.1 1217 CDS 100% 2.640 1.848 N Pip5kl1 n/a
9 TRCN0000025101 GTATGACATCAAGGGCTGCAA pLKO.1 1485 CDS 100% 2.640 1.848 N Pip5kl1 n/a
10 TRCN0000234455 TGCTGAAGGACCTCAACTTTC pLKO_005 1556 CDS 100% 10.800 6.480 N PIP5KL1 n/a
11 TRCN0000362235 TGCTGAAGGACCTCAACTTTC pLKO_005 1556 CDS 100% 10.800 6.480 N Pip5kl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.