Transcript: Mouse XM_017317462.1

PREDICTED: Mus musculus phosphodiesterase 10A (Pde10a), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde10a (23984)
Length:
4927
CDS:
2943..4796

Additional Resources:

NCBI RefSeq record:
XM_017317462.1
NBCI Gene record:
Pde10a (23984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321306 TTCCTACTCGACGTATCAAAG pLKO_005 4572 CDS 100% 10.800 15.120 N Pde10a n/a
2 TRCN0000321240 GCTTGGGCTTCCGTAGCAATA pLKO_005 4500 CDS 100% 10.800 8.640 N Pde10a n/a
3 TRCN0000321307 CTTGAACACATCATGATATAT pLKO_005 4629 CDS 100% 15.000 10.500 N Pde10a n/a
4 TRCN0000077320 CGACGGATTTGCACTGTACTT pLKO.1 4145 CDS 100% 4.950 3.465 N Pde10a n/a
5 TRCN0000077319 CGACGTATCAAAGACATACTT pLKO.1 4580 CDS 100% 5.625 3.375 N Pde10a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07690 pDONR223 100% 25.8% 28% None (many diffs) n/a
2 ccsbBroad304_07690 pLX_304 0% 25.8% 28% V5 (many diffs) n/a
3 TRCN0000477378 CGTGACATACTACGCATGCAACGC pLX_317 17.5% 25.8% 28% V5 (many diffs) n/a
4 TRCN0000487706 TACCGCGTATTGAGCTCGGTTCTG pLX_317 10.1% 25.8% 28% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV