Transcript: Mouse XM_017317477.1

PREDICTED: Mus musculus olfactory receptor 91 (Olfr91), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr91 (258470)
Length:
2054
CDS:
199..1137

Additional Resources:

NCBI RefSeq record:
XM_017317477.1
NBCI Gene record:
Olfr91 (258470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186768 GATGAGGATAAACTCCACTGA pLKO.1 867 CDS 100% 2.640 1.848 N Olfr91 n/a
2 TRCN0000009369 CTTGTCTCTTACGGAGCCATT pLKO.1 835 CDS 100% 4.050 2.430 N OR2H2 n/a
3 TRCN0000188853 GCTCTTCATCTTCCTGTCCTT pLKO.1 492 CDS 100% 2.640 1.584 N Olfr91 n/a
4 TRCN0000189142 GAGCCTCATCCTTGTCTCTTA pLKO.1 825 CDS 100% 4.950 2.475 Y Olfr92 n/a
5 TRCN0000357829 TTGTCTCTTACGGAGCCATTA pLKO_005 836 CDS 100% 10.800 7.560 N OR2H2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02970 pDONR223 100% 84.9% 83.5% None (many diffs) n/a
2 ccsbBroad304_02970 pLX_304 0% 84.9% 83.5% V5 (many diffs) n/a
3 TRCN0000468029 GAGGTTACCGTCTGTAGGGCAGGT pLX_317 35.5% 84.9% 83.5% V5 (many diffs) n/a
Download CSV