Transcript: Mouse XM_017317595.1

PREDICTED: Mus musculus interleukin 1 receptor, type I (Il1r1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Il1r1 (16177)
Length:
4943
CDS:
414..2135

Additional Resources:

NCBI RefSeq record:
XM_017317595.1
NBCI Gene record:
Il1r1 (16177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012342 CGTGAGCTTCTTCGGAGTAAA pLKO.1 926 CDS 100% 13.200 18.480 N Il1r1 n/a
2 TRCN0000012340 CGACACCATAATTTGGTACAA pLKO.1 569 CDS 100% 4.950 6.930 N Il1r1 n/a
3 TRCN0000344988 CGACACCATAATTTGGTACAA pLKO_005 569 CDS 100% 4.950 6.930 N Il1r1 n/a
4 TRCN0000012341 CCATTGTCTAAACACCGCTTA pLKO.1 2046 CDS 100% 4.050 5.670 N Il1r1 n/a
5 TRCN0000345063 CCATTGTCTAAACACCGCTTA pLKO_005 2046 CDS 100% 4.050 5.670 N Il1r1 n/a
6 TRCN0000012338 CCGTACTTTCTGATGGTGTTT pLKO.1 4577 3UTR 100% 4.950 3.960 N Il1r1 n/a
7 TRCN0000345064 CCGTACTTTCTGATGGTGTTT pLKO_005 4577 3UTR 100% 4.950 3.960 N Il1r1 n/a
8 TRCN0000012339 CCAGATTCTATTCAGTTCATT pLKO.1 1911 CDS 100% 5.625 3.938 N Il1r1 n/a
9 TRCN0000344990 CCAGATTCTATTCAGTTCATT pLKO_005 1911 CDS 100% 5.625 3.938 N Il1r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.