Transcript: Mouse XM_017317602.1

PREDICTED: Mus musculus ceramide kinase-like (Cerkl), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cerkl (228094)
Length:
3855
CDS:
148..1596

Additional Resources:

NCBI RefSeq record:
XM_017317602.1
NBCI Gene record:
Cerkl (228094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025610 GCGAAGAGACTTTGCTATAAT pLKO.1 1080 CDS 100% 15.000 21.000 N Cerkl n/a
2 TRCN0000025609 CCACTCGATCAGAATTTGTAA pLKO.1 1358 CDS 100% 5.625 7.875 N Cerkl n/a
3 TRCN0000025613 GTGGAGACTTATATCATTGAA pLKO.1 1429 CDS 100% 5.625 7.875 N Cerkl n/a
4 TRCN0000360875 ACTCCACGCTGGATCTTATTA pLKO_005 452 CDS 100% 15.000 12.000 N Cerkl n/a
5 TRCN0000360876 ATTCCAGCAGGATCTACTAAC pLKO_005 859 CDS 100% 10.800 8.640 N Cerkl n/a
6 TRCN0000025611 CCAAGACTGATCAGGCTCTAT pLKO.1 2422 3UTR 100% 4.950 3.960 N Cerkl n/a
7 TRCN0000367955 GGAGTCTGTCCACGTCTATTA pLKO_005 588 CDS 100% 13.200 9.240 N Cerkl n/a
8 TRCN0000025612 GCAACCATGCATATTATACTA pLKO.1 922 CDS 100% 5.625 3.938 N Cerkl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.