Transcript: Mouse XM_017317618.1

PREDICTED: Mus musculus mitochondrial ribosomal protein L14 (Mrpl14), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrpl14 (68463)
Length:
1246
CDS:
830..1165

Additional Resources:

NCBI RefSeq record:
XM_017317618.1
NBCI Gene record:
Mrpl14 (68463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179141 GCATCCACGTCTATAACAAGA pLKO.1 897 CDS 100% 4.950 6.930 N Mrpl14 n/a
2 TRCN0000276861 GCATCCACGTCTATAACAAGA pLKO_005 897 CDS 100% 4.950 6.930 N Mrpl14 n/a
3 TRCN0000183938 CCATCGCTCAGAACTTTGTGT pLKO.1 1143 CDS 100% 3.000 2.400 N Mrpl14 n/a
4 TRCN0000276863 CAGAAGGGAAGGAGAGTATTC pLKO_005 1111 CDS 100% 10.800 7.560 N Mrpl14 n/a
5 TRCN0000179659 GTGCATCCACGTCTATAACAA pLKO.1 895 CDS 100% 5.625 3.938 N Mrpl14 n/a
6 TRCN0000179560 GCAGAAGAAGAAAGCACTCAT pLKO.1 964 CDS 100% 4.950 3.465 N Mrpl14 n/a
7 TRCN0000276912 GCAGAAGAAGAAAGCACTCAT pLKO_005 964 CDS 100% 4.950 3.465 N Mrpl14 n/a
8 TRCN0000184351 GTTTGACTCCAACAACGTGGT pLKO.1 1024 CDS 100% 2.160 1.512 N Mrpl14 n/a
9 TRCN0000276862 GTTTGACTCCAACAACGTGGT pLKO_005 1024 CDS 100% 2.160 1.512 N Mrpl14 n/a
10 TRCN0000195932 CCTCATTGAGGACAATGGCAA pLKO.1 1045 CDS 100% 0.264 0.185 N Mrpl14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03985 pDONR223 100% 66.2% 68.9% None (many diffs) n/a
2 ccsbBroad304_03985 pLX_304 0% 66.2% 68.9% V5 (many diffs) n/a
Download CSV