Transcript: Mouse XM_017317659.1

PREDICTED: Mus musculus family with sequence similarity 98, member A (Fam98a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam98a (72722)
Length:
2583
CDS:
510..1472

Additional Resources:

NCBI RefSeq record:
XM_017317659.1
NBCI Gene record:
Fam98a (72722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264360 CGCTCACTCTTGTCGCCTAAA pLKO_005 684 CDS 100% 10.800 15.120 N Fam98a n/a
2 TRCN0000264358 GCCTTTAGTTGACCGGTAAAC pLKO_005 1725 3UTR 100% 10.800 15.120 N Fam98a n/a
3 TRCN0000181009 GAAGCTGCTAATCAAACGCTT pLKO.1 581 CDS 100% 2.640 3.696 N Fam98a n/a
4 TRCN0000374721 TTGGACAAGGAAGACATTATA pLKO_005 1444 CDS 100% 15.000 10.500 N Fam98a n/a
5 TRCN0000181179 CCAAGCCATAGCCAATGAATA pLKO.1 548 CDS 100% 13.200 9.240 N Fam98a n/a
6 TRCN0000374720 TTGCTAGAGCTCAAGTAATAG pLKO_005 1492 3UTR 100% 13.200 9.240 N Fam98a n/a
7 TRCN0000374657 AGGCTATCAGTATAGTCATTC pLKO_005 1418 CDS 100% 10.800 7.560 N Fam98a n/a
8 TRCN0000283010 GGACGGTGCTTATCGAGATTC pLKO_005 1106 CDS 100% 10.800 7.560 N Fam98a n/a
9 TRCN0000147316 GCACATTCAGTAGCCTTATTT pLKO.1 2042 3UTR 100% 15.000 21.000 N FAM98A n/a
10 TRCN0000278968 GCACATTCAGTAGCCTTATTT pLKO_005 2042 3UTR 100% 15.000 21.000 N FAM98A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07968 pDONR223 100% 55.7% 58.6% None (many diffs) n/a
2 ccsbBroad304_07968 pLX_304 0% 55.7% 58.6% V5 (many diffs) n/a
3 TRCN0000477620 TCAAGTGGCAATTGTATAACACGT pLX_317 28.7% 55.7% 58.6% V5 (many diffs) n/a
4 ccsbBroadEn_07969 pDONR223 100% 55.6% 58.4% None (many diffs) n/a
5 ccsbBroad304_07969 pLX_304 0% 55.6% 58.4% V5 (many diffs) n/a
6 TRCN0000477556 AGTACAGGTGTTCAGATGACTCCA pLX_317 12.6% 55.6% 58.4% V5 (many diffs) n/a
Download CSV