Transcript: Mouse XM_017317938.1

PREDICTED: Mus musculus potassium channel tetramerisation domain containing 16 (Kctd16), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd16 (383348)
Length:
1728
CDS:
375..1658

Additional Resources:

NCBI RefSeq record:
XM_017317938.1
NBCI Gene record:
Kctd16 (383348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069801 GAAGTCATAGAGCTGAATGTT pLKO.1 447 CDS 100% 5.625 3.938 N Kctd16 n/a
2 TRCN0000069798 CCGATTATTACATCCTGTGAA pLKO.1 116 5UTR 100% 4.950 3.465 N Kctd16 n/a
3 TRCN0000129366 GCTGATCCAACAGTCAGAGAT pLKO.1 1427 CDS 100% 4.950 3.465 N KCTD16 n/a
4 TRCN0000069799 CAGAAAGATACACCTCCAGAT pLKO.1 1030 CDS 100% 4.050 2.835 N Kctd16 n/a
5 TRCN0000069802 CGGAAGAATTTCCTTGGCAAA pLKO.1 959 CDS 100% 4.050 2.835 N Kctd16 n/a
6 TRCN0000129601 CTGCCTGATCACTTTCCAGAA pLKO.1 660 CDS 100% 4.050 2.835 N KCTD16 n/a
7 TRCN0000069800 GTTCCGTTATATTCTGGACTA pLKO.1 617 CDS 100% 4.050 2.835 N Kctd16 n/a
8 TRCN0000128551 GTTCCGTTATATTCTGGACTA pLKO.1 617 CDS 100% 4.050 2.835 N KCTD16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03827 pDONR223 100% 89.4% 96.2% None (many diffs) n/a
2 ccsbBroad304_03827 pLX_304 0% 89.4% 96.2% V5 (many diffs) n/a
3 TRCN0000476014 TTGCCGCTCATATGCTACTTAATG pLX_317 28% 89.4% 96.2% V5 (many diffs) n/a
Download CSV