Transcript: Mouse XM_017317971.1

PREDICTED: Mus musculus synuclein, alpha interacting protein (synphilin) (Sncaip), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sncaip (67847)
Length:
3704
CDS:
443..3160

Additional Resources:

NCBI RefSeq record:
XM_017317971.1
NBCI Gene record:
Sncaip (67847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085374 GCCTTATTCATTACGCAGGTT pLKO.1 1524 CDS 100% 2.640 3.696 N Sncaip n/a
2 TRCN0000152655 GCCTTATTCATTACGCAGGTT pLKO.1 1524 CDS 100% 2.640 3.696 N SNCAIP n/a
3 TRCN0000280250 GCCTTATTCATTACGCAGGTT pLKO_005 1524 CDS 100% 2.640 3.696 N SNCAIP n/a
4 TRCN0000085376 GAATACAAGTTCTTGGAAGTT pLKO.1 2040 CDS 100% 4.950 3.465 N Sncaip n/a
5 TRCN0000085375 GCAGAAGATGTGACTCACAAA pLKO.1 537 CDS 100% 4.950 3.465 N Sncaip n/a
6 TRCN0000085373 GCCTTGAACTAAATGGAGAAA pLKO.1 2742 CDS 100% 4.950 3.465 N Sncaip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11395 pDONR223 100% 75.5% 75.3% None (many diffs) n/a
2 ccsbBroad304_11395 pLX_304 0% 75.5% 75.3% V5 (many diffs) n/a
3 TRCN0000476088 GCCCTACCTCTTATGCCTTCTACG pLX_317 11.1% 75.5% 75.3% V5 (many diffs) n/a
Download CSV