Transcript: Mouse XM_017317976.1

PREDICTED: Mus musculus cyclin Y (Ccny), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccny (67974)
Length:
1069
CDS:
276..977

Additional Resources:

NCBI RefSeq record:
XM_017317976.1
NBCI Gene record:
Ccny (67974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448350 CCGAAGTGCCACCTGATTATG pLKO_005 322 CDS 100% 13.200 10.560 N Ccny n/a
2 TRCN0000106083 CTCTTGACATACGCAGAGATT pLKO.1 453 CDS 100% 4.950 3.960 N Ccny n/a
3 TRCN0000106084 GCCAATTGGAAGCGCATTGTT pLKO.1 486 CDS 100% 5.625 3.938 N Ccny n/a
4 TRCN0000106081 GCGATATATTACCACATCAAA pLKO.1 234 5UTR 100% 5.625 3.938 N Ccny n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05228 pDONR223 100% 51.7% 53.2% None (many diffs) n/a
2 ccsbBroad304_05228 pLX_304 0% 51.7% 53.2% V5 (many diffs) n/a
3 TRCN0000492295 CACGAGTGGCAGCAAAAACTGTGA pLX_317 45.2% 51.7% 53.2% V5 (many diffs) n/a
Download CSV