Transcript: Mouse XM_017317993.1

PREDICTED: Mus musculus oxysterol binding protein-like 2 (Osbpl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Osbpl2 (228983)
Length:
3028
CDS:
483..1937

Additional Resources:

NCBI RefSeq record:
XM_017317993.1
NBCI Gene record:
Osbpl2 (228983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105284 CGACTTCAGTGTGTGGAGTAT pLKO.1 698 CDS 100% 4.950 3.960 N Osbpl2 n/a
2 TRCN0000308314 CGACTTCAGTGTGTGGAGTAT pLKO_005 698 CDS 100% 4.950 3.960 N Osbpl2 n/a
3 TRCN0000105281 CGGCCATTACTTTGAGCGTAA pLKO.1 1889 CDS 100% 4.050 3.240 N Osbpl2 n/a
4 TRCN0000105280 GCAGCCTTGGAATCCTCAAAT pLKO.1 1955 3UTR 100% 13.200 9.240 N Osbpl2 n/a
5 TRCN0000308385 GCAGCCTTGGAATCCTCAAAT pLKO_005 1955 3UTR 100% 13.200 9.240 N Osbpl2 n/a
6 TRCN0000150659 GAGCTGCTCAAACATAATGAA pLKO.1 1146 CDS 100% 5.625 3.938 N OSBPL2 n/a
7 TRCN0000105283 GCAGCTATGGATAGAGCAGTA pLKO.1 1217 CDS 100% 4.050 2.835 N Osbpl2 n/a
8 TRCN0000308315 GCAGCTATGGATAGAGCAGTA pLKO_005 1217 CDS 100% 4.050 2.835 N Osbpl2 n/a
9 TRCN0000105282 GCTCTTTATCATGTATGGCAA pLKO.1 1364 CDS 100% 2.640 1.848 N Osbpl2 n/a
10 TRCN0000331885 GCTCTTTATCATGTATGGCAA pLKO_005 1364 CDS 100% 2.640 1.848 N Osbpl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02265 pDONR223 100% 84.9% 89% None (many diffs) n/a
2 ccsbBroad304_02265 pLX_304 0% 84.9% 89% V5 (many diffs) n/a
3 TRCN0000466865 CTAACAAACCCCGGCATAGGGAAA pLX_317 30.5% 84.9% 89% V5 (many diffs) n/a
Download CSV