Transcript: Mouse XM_017318033.1

PREDICTED: Mus musculus PDZ domain containing 7 (Pdzd7), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdzd7 (100503041)
Length:
1845
CDS:
391..1830

Additional Resources:

NCBI RefSeq record:
XM_017318033.1
NBCI Gene record:
Pdzd7 (100503041)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14276 pDONR223 100% 80.6% 79% None (many diffs) n/a
2 ccsbBroad304_14276 pLX_304 0% 80.6% 79% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479509 CTTACGGTTTCCACAAAGGTCACC pLX_317 17.6% 80.6% 79% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV