Transcript: Mouse XM_017318247.1

PREDICTED: Mus musculus zinc finger protein 950 (Zfp950), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp950 (414758)
Length:
672
CDS:
139..516

Additional Resources:

NCBI RefSeq record:
XM_017318247.1
NBCI Gene record:
Zfp950 (414758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095228 AGTGGGCTTTGCTGGATCATT pLKO.1 188 CDS 100% 5.625 3.375 N Zfp950 n/a
2 TRCN0000095225 CCTGACTGCTATAGGCTACAA pLKO.1 255 CDS 100% 4.950 2.970 N Zfp950 n/a
3 TRCN0000095227 GACGACCATAATATTGAAGAA pLKO.1 280 CDS 100% 4.950 2.970 N Zfp950 n/a
4 TRCN0000243741 ACTCAGGAAGAGTGGGCTTTG pLKO_005 178 CDS 100% 6.000 3.000 Y Gm14411 n/a
5 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 166 CDS 100% 2.640 1.320 Y Zfp950 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.