Transcript: Mouse XM_017318428.1

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class A (Piga), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Piga (18700)
Length:
3603
CDS:
129..1586

Additional Resources:

NCBI RefSeq record:
XM_017318428.1
NBCI Gene record:
Piga (18700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311227 ATAGGACCTGCACCCATAATA pLKO_005 211 CDS 100% 15.000 21.000 N Piga n/a
2 TRCN0000077122 GCCATTGCTCAGGTACATATT pLKO.1 458 CDS 100% 13.200 18.480 N Piga n/a
3 TRCN0000302844 GCCATTGCTCAGGTACATATT pLKO_005 458 CDS 100% 13.200 18.480 N Piga n/a
4 TRCN0000305029 TAGGAGGCATGATAGTGTAAT pLKO_005 788 CDS 100% 13.200 18.480 N Piga n/a
5 TRCN0000304996 TCGGGAGAGAATTACGATAAT pLKO_005 482 CDS 100% 13.200 18.480 N Piga n/a
6 TRCN0000083345 CCTGAAATAGTGTCCGTCATT pLKO.1 726 CDS 100% 4.950 6.930 N PIGA n/a
7 TRCN0000222631 CCCATGCTTATGGAAATCGAA pLKO.1 340 CDS 100% 3.000 4.200 N Piga n/a
8 TRCN0000077121 CCAGACTCTTTCATTGATGTT pLKO.1 1470 CDS 100% 4.950 3.960 N Piga n/a
9 TRCN0000077118 GCCAAATGTTTCTGGATTGTT pLKO.1 1886 3UTR 100% 5.625 3.938 N Piga n/a
10 TRCN0000302928 GCCAAATGTTTCTGGATTGTT pLKO_005 1886 3UTR 100% 5.625 3.938 N Piga n/a
11 TRCN0000083347 CCATGCTTATGGAAATCGAAA pLKO.1 341 CDS 100% 4.950 3.465 N PIGA n/a
12 TRCN0000077119 CGGGAAAGATACCAACTACAT pLKO.1 954 CDS 100% 4.950 3.465 N Piga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01198 pDONR223 100% 87.4% 87.6% None (many diffs) n/a
2 ccsbBroad304_01198 pLX_304 0% 87.4% 87.6% V5 (many diffs) n/a
3 TRCN0000492238 GTATCCGACTGATATCGTAATGCG pLX_317 20.6% 87.4% 87.6% V5 (many diffs) n/a
Download CSV