Transcript: Mouse XM_017318439.1

PREDICTED: Mus musculus retinitis pigmentosa 2 homolog (Rp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rp2 (19889)
Length:
4413
CDS:
359..1291

Additional Resources:

NCBI RefSeq record:
XM_017318439.1
NBCI Gene record:
Rp2 (19889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215663 GATGTTGATAGCTTCTATAAC pLKO.1 1244 CDS 100% 13.200 18.480 N Rp2 n/a
2 TRCN0000216586 GGTATTATTTGCCGATGATTA pLKO.1 952 CDS 100% 13.200 18.480 N Rp2 n/a
3 TRCN0000173932 GCTGTGCTACTCAACCCATTA pLKO.1 627 CDS 100% 10.800 15.120 N Rp2 n/a
4 TRCN0000297628 GCTGTGCTACTCAACCCATTA pLKO_005 627 CDS 100% 10.800 15.120 N Rp2 n/a
5 TRCN0000217516 GAAGCGGATTGTGGTATTAAG pLKO.1 1290 CDS 100% 13.200 10.560 N Rp2 n/a
6 TRCN0000216349 GTGAGAACTGTAACATCTATA pLKO.1 438 CDS 100% 13.200 10.560 N Rp2 n/a
7 TRCN0000193109 CCAGGAAACTAATTGATGAGA pLKO.1 987 CDS 100% 3.000 2.400 N Rp2 n/a
8 TRCN0000279197 ATCATGTCTTGTGGTATTATT pLKO_005 940 CDS 100% 15.000 10.500 N Rp2 n/a
9 TRCN0000216301 GATAATCTAGACAGGTTATTC pLKO.1 2423 3UTR 100% 13.200 9.240 N Rp2 n/a
10 TRCN0000279198 TGTTAGTCATTTAGCAATTAG pLKO_005 1358 3UTR 100% 13.200 9.240 N Rp2 n/a
11 TRCN0000174346 CCTCAGTATCTTCAATAACAT pLKO.1 727 CDS 100% 5.625 3.938 N Rp2 n/a
12 TRCN0000279132 CCTCAGTATCTTCAATAACAT pLKO_005 727 CDS 100% 5.625 3.938 N Rp2 n/a
13 TRCN0000174540 CGTATCAATAATGGTGTGTAA pLKO.1 3279 3UTR 100% 4.950 3.465 N Rp2 n/a
14 TRCN0000176075 GCAGGACAACAATTTGTCATT pLKO.1 410 CDS 100% 0.495 0.347 N Rp2 n/a
15 TRCN0000279196 GCAGGACAACAATTTGTCATT pLKO_005 410 CDS 100% 0.495 0.347 N Rp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01412 pDONR223 100% 77.1% 79.7% None (many diffs) n/a
2 ccsbBroad304_01412 pLX_304 0% 77.1% 79.7% V5 (many diffs) n/a
3 TRCN0000473429 GTAAATGTGGGTTCTTCTCTCCTT pLX_317 36.6% 77.1% 79.7% V5 (many diffs) n/a
4 ccsbBroadEn_14829 pDONR223 0% 77.1% 79.7% None (many diffs) n/a
5 ccsbBroad304_14829 pLX_304 0% 77.1% 79.7% V5 (many diffs) n/a
6 TRCN0000469591 GACCAACTCTGTTTCGCACCTGGG pLX_317 42.8% 77.1% 79.7% V5 (many diffs) n/a
Download CSV