Transcript: Mouse XM_017318459.1

PREDICTED: Mus musculus translocase of inner mitochondrial membrane 17b (Timm17b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Timm17b (21855)
Length:
992
CDS:
102..701

Additional Resources:

NCBI RefSeq record:
XM_017318459.1
NBCI Gene record:
Timm17b (21855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348207 AGCTTCATACGTGTAACAATT pLKO_005 909 3UTR 100% 13.200 18.480 N Timm17b n/a
2 TRCN0000114229 CCGGTTCAGAGGTAGTGTCAA pLKO.1 239 CDS 100% 4.950 3.960 N Timm17b n/a
3 TRCN0000334078 CCGGTTCAGAGGTAGTGTCAA pLKO_005 239 CDS 100% 4.950 3.960 N Timm17b n/a
4 TRCN0000348136 GCATCCTTCTCACCCGCTATA pLKO_005 571 CDS 100% 10.800 7.560 N Timm17b n/a
5 TRCN0000114227 CCATGGCGAATTGTGGATGAT pLKO.1 129 CDS 100% 4.950 3.465 N Timm17b n/a
6 TRCN0000180133 CCATGGCGAATTGTGGATGAT pLKO.1 129 CDS 100% 4.950 3.465 N TIMM17B n/a
7 TRCN0000114230 GCTTTCACCATGGGTGTCATT pLKO.1 159 CDS 100% 4.950 3.465 N Timm17b n/a
8 TRCN0000334077 GCTTTCACCATGGGTGTCATT pLKO_005 159 CDS 100% 4.950 3.465 N Timm17b n/a
9 TRCN0000114228 CCGCTATACTGCCCAGCAGTT pLKO.1 584 CDS 100% 1.350 0.945 N Timm17b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02368 pDONR223 100% 77.2% 82.9% None (many diffs) n/a
2 ccsbBroad304_02368 pLX_304 0% 77.2% 82.9% V5 (many diffs) n/a
3 TRCN0000480476 TTACTCAGGGATTCTGAGAATTTC pLX_317 81.9% 77.2% 82.9% V5 (many diffs) n/a
Download CSV