Transcript: Mouse XM_017318506.1

PREDICTED: Mus musculus Kruppel-like factor 8 (Klf8), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klf8 (245671)
Length:
6290
CDS:
205..1272

Additional Resources:

NCBI RefSeq record:
XM_017318506.1
NBCI Gene record:
Klf8 (245671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434950 GTTCGATGCAGGTATTCAAAC pLKO_005 254 CDS 100% 10.800 15.120 N Klf8 n/a
2 TRCN0000417942 CATCATGAGCCAGCGACAATG pLKO_005 943 CDS 100% 10.800 7.560 N Klf8 n/a
3 TRCN0000082168 CGGCTCTTCATATTCCACTTT pLKO.1 1437 3UTR 100% 4.950 3.465 N Klf8 n/a
4 TRCN0000082169 GCCATTACTGTCCCACTCATT pLKO.1 790 CDS 100% 4.950 3.465 N Klf8 n/a
5 TRCN0000082170 CCAAATAAGATGAGTGGACTA pLKO.1 697 CDS 100% 4.050 2.835 N Klf8 n/a
6 TRCN0000082171 GCCAAATAAGATGAGTGGACT pLKO.1 696 CDS 100% 2.640 1.848 N Klf8 n/a
7 TRCN0000082172 GAACCTGTTGATCTCTCCTTT pLKO.1 448 CDS 100% 4.950 2.970 N Klf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.