Transcript: Mouse XM_017318578.1

PREDICTED: Mus musculus tetraspanin 6 (Tspan6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspan6 (56496)
Length:
1642
CDS:
277..750

Additional Resources:

NCBI RefSeq record:
XM_017318578.1
NBCI Gene record:
Tspan6 (56496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348138 TCTCGTGCCATAACGAATAAC pLKO_005 712 CDS 100% 13.200 18.480 N Tspan6 n/a
2 TRCN0000382102 TGTTGCGGTGTCACCAATTAC pLKO_005 469 CDS 100% 13.200 18.480 N Tspan6 n/a
3 TRCN0000382448 GTCAACGAAGAGGGTTGTTTC pLKO_005 586 CDS 100% 10.800 15.120 N Tspan6 n/a
4 TRCN0000094631 CCGGTCATTACTTGTTTGAAA pLKO.1 29 5UTR 100% 5.625 7.875 N Tspan6 n/a
5 TRCN0000334082 CCGGTCATTACTTGTTTGAAA pLKO_005 29 5UTR 100% 5.625 7.875 N Tspan6 n/a
6 TRCN0000094633 CGCGATGTTTCTGACACTCAT pLKO.1 291 CDS 100% 4.950 6.930 N Tspan6 n/a
7 TRCN0000381568 CAACTCCACAGGAGACTATAG pLKO_005 411 CDS 100% 10.800 8.640 N Tspan6 n/a
8 TRCN0000094629 GCTGATTCAATCAAGATACTT pLKO.1 860 3UTR 100% 5.625 4.500 N Tspan6 n/a
9 TRCN0000363765 GCTGATTCAATCAAGATACTT pLKO_005 860 3UTR 100% 5.625 4.500 N Tspan6 n/a
10 TRCN0000094632 GCGATGTTTCTGACACTCATT pLKO.1 292 CDS 100% 4.950 3.960 N Tspan6 n/a
11 TRCN0000334151 GCGATGTTTCTGACACTCATT pLKO_005 292 CDS 100% 4.950 3.960 N Tspan6 n/a
12 TRCN0000380222 ATTGGAAAGGTACGAACTATT pLKO_005 494 CDS 100% 13.200 9.240 N Tspan6 n/a
13 TRCN0000382520 GGGAGTCGTTGCTGGAATTTC pLKO_005 639 CDS 100% 13.200 9.240 N Tspan6 n/a
14 TRCN0000379200 TGGCACAGGCACTGTCATTAT pLKO_005 207 5UTR 100% 13.200 9.240 N Tspan6 n/a
15 TRCN0000094630 GCCGCCATTGTTGGATTTGTT pLKO.1 331 CDS 100% 5.625 3.938 N Tspan6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07078 pDONR223 100% 56% 57.9% None (many diffs) n/a
2 ccsbBroad304_07078 pLX_304 0% 56% 57.9% V5 (many diffs) n/a
3 TRCN0000473913 AACTCCTTGGCACCGGACACGGCA pLX_317 65.1% 56% 57.9% V5 (many diffs) n/a
Download CSV