Transcript: Mouse XM_017318900.1

PREDICTED: Mus musculus vomeronasal 2, receptor, 122 (Vmn2r122), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r122 (22308)
Length:
2736
CDS:
74..2521

Additional Resources:

NCBI RefSeq record:
XM_017318900.1
NBCI Gene record:
Vmn2r122 (22308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027954 GCCAAATACCTTGTAGATATT pLKO.1 1091 CDS 100% 13.200 9.240 N Vmn2r122 n/a
2 TRCN0000104934 CTGGATCAAGAATATGCACAA pLKO.1 419 CDS 100% 4.050 2.835 N Vmn2r122 n/a
3 TRCN0000028006 CCTCCAAAGAACGGTGTCATT pLKO.1 1780 CDS 100% 4.950 2.970 N Vmn2r122 n/a
4 TRCN0000028023 GCACACCACAAAGATGAGATT pLKO.1 1034 CDS 100% 4.950 2.970 N Vmn2r122 n/a
5 TRCN0000104931 GCATGGGATCTGTTTGGCTTT pLKO.1 766 CDS 100% 4.050 2.430 N Vmn2r122 n/a
6 TRCN0000104933 GCAGGAAGTGAATATGAGCTT pLKO.1 284 CDS 100% 2.640 1.584 N Vmn2r122 n/a
7 TRCN0000028028 CCCTTTATTGACAGAGATATA pLKO.1 2228 CDS 100% 13.200 6.600 Y Vmn2r122 n/a
8 TRCN0000028019 CCACAAAGGTAAATTGCTTTA pLKO.1 2600 3UTR 100% 10.800 5.400 Y Vmn2r122 n/a
9 TRCN0000042747 CCAAAGAGTCAACAACTTCAT pLKO.1 1532 CDS 100% 4.950 2.475 Y Vmn2r89 n/a
10 TRCN0000104930 CCTCCCTTTATTGACAGAGAT pLKO.1 2225 CDS 100% 4.950 2.475 Y Vmn2r122 n/a
11 TRCN0000188381 CTAGGAACCTTCCTGACACAT pLKO.1 2367 CDS 100% 4.950 2.475 Y LOC436147 n/a
12 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 568 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
13 TRCN0000027902 GCAGGTGTCTTCCTTGATGAA pLKO.1 1363 CDS 100% 4.950 2.475 Y Vmn2r123 n/a
14 TRCN0000104932 GTGAAGATAATGATGGAGATT pLKO.1 177 CDS 100% 4.950 2.475 Y Vmn2r122 n/a
15 TRCN0000188910 GCTTTCAAGCTCACTACTCCA pLKO.1 2099 CDS 100% 2.640 1.320 Y LOC436147 n/a
16 TRCN0000257361 CAGACCACATTTGGAGTATTT pLKO_005 2027 CDS 100% 13.200 6.600 Y Gm20783 n/a
17 TRCN0000104881 GCTGTTGGAGTGAACCAAGTT pLKO.1 135 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.