Transcript: Mouse XM_017318941.1

PREDICTED: Mus musculus SH2 domain containing 3C (Sh2d3c), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sh2d3c (27387)
Length:
3314
CDS:
1372..2889

Additional Resources:

NCBI RefSeq record:
XM_017318941.1
NBCI Gene record:
Sh2d3c (27387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106050 CCAAGAATGTTCTGGGTTCAA pLKO.1 2987 3UTR 100% 4.950 6.930 N Sh2d3c n/a
2 TRCN0000106053 CGAAGCATTACCATGACTGAT pLKO.1 1381 CDS 100% 4.950 6.930 N Sh2d3c n/a
3 TRCN0000106052 CCACACGTACTTCCTTTCATT pLKO.1 2536 CDS 100% 5.625 3.938 N Sh2d3c n/a
4 TRCN0000426643 CCTTGCACTTCAAGATCAACA pLKO_005 1094 5UTR 100% 4.950 3.465 N SH2D3C n/a
5 TRCN0000106051 CGCTATGAGAAGTTTGACAAA pLKO.1 2812 CDS 100% 4.950 3.465 N Sh2d3c n/a
6 TRCN0000106054 CCTCAGCTATGTCCTGGAAAT pLKO.1 1654 CDS 100% 10.800 6.480 N Sh2d3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07536 pDONR223 100% 63.4% 65% None (many diffs) n/a
Download CSV