Transcript: Mouse XM_017319227.1

PREDICTED: Mus musculus protein phosphatase 6, catalytic subunit (Ppp6c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp6c (67857)
Length:
3800
CDS:
157..828

Additional Resources:

NCBI RefSeq record:
XM_017319227.1
NBCI Gene record:
Ppp6c (67857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080927 CGGTTTATCTCCTGATATCAA pLKO.1 402 CDS 100% 5.625 7.875 N Ppp6c n/a
2 TRCN0000080924 GCCTGGAGATACTGTACCAAA pLKO.1 322 CDS 100% 4.950 3.465 N Ppp6c n/a
3 TRCN0000080926 CCAAAGTTATTCCGAGCAGTT pLKO.1 754 CDS 100% 4.050 2.835 N Ppp6c n/a
4 TRCN0000080923 CCAACTTTCTTGTACCCTCTA pLKO.1 872 3UTR 100% 4.050 2.835 N Ppp6c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01270 pDONR223 100% 63.9% 63.2% None (many diffs) n/a
2 ccsbBroad304_01270 pLX_304 0% 63.9% 63.2% V5 (many diffs) n/a
3 TRCN0000471947 TCAGAATCTGCTTTGTGTCTCCAA pLX_317 45.2% 63.9% 63.2% V5 (many diffs) n/a
Download CSV