Transcript: Mouse XM_017319267.1

PREDICTED: Mus musculus LY6/PLAUR domain containing 6B (Lypd6b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lypd6b (71897)
Length:
2202
CDS:
371..946

Additional Resources:

NCBI RefSeq record:
XM_017319267.1
NBCI Gene record:
Lypd6b (71897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179345 GAAGGAATGATCTGCAACGTA pLKO.1 791 CDS 100% 3.000 4.200 N Lypd6b n/a
2 TRCN0000179162 GCAGGACACACAGTATTGTTT pLKO.1 637 CDS 100% 5.625 3.938 N Lypd6b n/a
3 TRCN0000179903 CAACCACACAAATGCAGTCTT pLKO.1 823 CDS 100% 4.950 3.465 N Lypd6b n/a
4 TRCN0000164910 GCTGTGAAGGAATGATCTGCA pLKO.1 786 CDS 100% 2.640 1.848 N LYPD6B n/a
5 TRCN0000195803 CACGAAGAAGTGTGCCTCTAA pLKO.1 700 CDS 100% 4.950 2.970 N Lypd6b n/a
6 TRCN0000196149 GCACAGACATACATGCAGGTA pLKO.1 1693 3UTR 100% 2.640 1.320 Y Lypd6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13155 pDONR223 100% 63.3% 63.8% None (many diffs) n/a
2 ccsbBroad304_13155 pLX_304 0% 63.3% 63.8% V5 (many diffs) n/a
Download CSV