Transcript: Mouse XM_017319444.1

PREDICTED: Mus musculus cyclin A2 (Ccna2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccna2 (12428)
Length:
3363
CDS:
726..1994

Additional Resources:

NCBI RefSeq record:
XM_017319444.1
NBCI Gene record:
Ccna2 (12428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077767 GCTTCGAAGTTTGAAGAAATA pLKO.1 1485 CDS 100% 13.200 9.240 N Ccna2 n/a
2 TRCN0000045284 CCTTAGGGAAATGGAGGTTAA pLKO.1 1250 CDS 100% 10.800 7.560 N CCNA2 n/a
3 TRCN0000077764 CCTGACTATCAAGAAGACATT pLKO.1 1221 CDS 100% 4.950 3.465 N Ccna2 n/a
4 TRCN0000077766 GTTAATGAAGTACCTGACTAT pLKO.1 1209 CDS 100% 4.950 3.465 N Ccna2 n/a
5 TRCN0000077765 CCCAACAGTCAATACGGGAAA pLKO.1 1909 CDS 100% 4.050 2.835 N Ccna2 n/a
6 TRCN0000293912 CAACCCACCAGAGACACTAAA pLKO_005 1967 CDS 100% 13.200 9.240 N CCNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05946 pDONR223 100% 83.8% .7% None (many diffs) n/a
2 ccsbBroad304_05946 pLX_304 0% 83.8% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476985 AGTCCTGTTTTAACGAGAATCACA pLX_317 18.1% 83.8% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV