Transcript: Mouse XM_017319451.1

PREDICTED: Mus musculus TROVE domain family, member 2 (Trove2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trove2 (20822)
Length:
3398
CDS:
166..1782

Additional Resources:

NCBI RefSeq record:
XM_017319451.1
NBCI Gene record:
Trove2 (20822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159107 GCTCGTATACATCCATTTCAT pLKO.1 1114 CDS 100% 5.625 7.875 N RO60 n/a
2 TRCN0000055374 GCCTGTGATATGGTTCCGTTT pLKO.1 1411 CDS 100% 4.050 5.670 N Trove2 n/a
3 TRCN0000055373 GCGGACATAAACACAAAGCAA pLKO.1 472 CDS 100% 3.000 4.200 N Trove2 n/a
4 TRCN0000055377 CGCAGATGTCTTCGTTGTGTT pLKO.1 1545 CDS 100% 4.950 3.960 N Trove2 n/a
5 TRCN0000055375 GCTCTGGATGTAATTCGGAAT pLKO.1 1741 CDS 100% 4.050 3.240 N Trove2 n/a
6 TRCN0000444171 ATGAACCTCACCAGGTAAATT pLKO_005 2233 3UTR 100% 15.000 10.500 N Trove2 n/a
7 TRCN0000450948 ACAAATCACTTGAAGTCTAAA pLKO_005 943 CDS 100% 13.200 9.240 N Trove2 n/a
8 TRCN0000450460 GAGTGAGACTCAAGTAGTTAA pLKO_005 198 CDS 100% 13.200 9.240 N Trove2 n/a
9 TRCN0000448979 GGATGACATCAAATGGCTTTA pLKO_005 1664 CDS 100% 10.800 7.560 N Trove2 n/a
10 TRCN0000453281 TCCTGCTAAATTGATTGTTTG pLKO_005 1641 CDS 100% 10.800 7.560 N Trove2 n/a
11 TRCN0000055376 CCAGTTTAAGAAAGACCTGAA pLKO.1 552 CDS 100% 4.050 2.835 N Trove2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07000 pDONR223 100% 85.3% 89.7% None (many diffs) n/a
2 ccsbBroad304_07000 pLX_304 0% 85.3% 89.7% V5 (many diffs) n/a
3 TRCN0000465626 CTGGGTGGGATTCAGCACTTATCT pLX_317 23.9% 85.3% 89.7% V5 (many diffs) n/a
Download CSV