Transcript: Mouse XM_017319614.1

PREDICTED: Mus musculus coiled-coil domain containing 169 (Ccdc169), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc169 (320604)
Length:
831
CDS:
243..641

Additional Resources:

NCBI RefSeq record:
XM_017319614.1
NBCI Gene record:
Ccdc169 (320604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264718 GTGGAATCTTTAAACGTATTA pLKO_005 309 CDS 100% 13.200 18.480 N Ccdc169 n/a
2 TRCN0000264719 AGTGAAAGAATATGCGTTTAG pLKO_005 371 CDS 100% 10.800 15.120 N Ccdc169 n/a
3 TRCN0000264720 CCGTTCCTACATCGCGGAAAT pLKO_005 437 CDS 100% 10.800 15.120 N Ccdc169 n/a
4 TRCN0000190573 GCCAAGAAAGGACCAGTTAAA pLKO.1 579 CDS 100% 13.200 9.240 N Ccdc169 n/a
5 TRCN0000264722 GCCAAGAAAGGACCAGTTAAA pLKO_005 579 CDS 100% 13.200 9.240 N Ccdc169 n/a
6 TRCN0000201765 GCCAGTGGAATCTTTAAACGT pLKO.1 305 CDS 100% 3.000 2.100 N Ccdc169 n/a
7 TRCN0000190750 GCCAAGTGAAAGAATATGCGT pLKO.1 367 CDS 100% 0.750 0.525 N Ccdc169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.