Transcript: Mouse XM_017319879.1

PREDICTED: Mus musculus predicted gene 13102 (Gm13102), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm13102 (100041077)
Length:
1579
CDS:
16..1545

Additional Resources:

NCBI RefSeq record:
XM_017319879.1
NBCI Gene record:
Gm13102 (100041077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272174 GTCTACTTTGAGAGTACAATA pLKO_005 1393 CDS 100% 13.200 7.920 N Gm13102 n/a
2 TRCN0000272175 CCTACAGGAAGCCCGTATTAT pLKO_005 783 CDS 100% 15.000 7.500 Y Gm13102 n/a
3 TRCN0000281874 GTCCATACACTGGGATATATA pLKO_005 669 CDS 100% 15.000 7.500 Y Gm13102 n/a
4 TRCN0000284651 CAGGTCTCAAGAGATTCATTA pLKO_005 1516 CDS 100% 13.200 6.600 Y Gm13102 n/a
5 TRCN0000270240 GAACCTACAAGTGCTTGATTT pLKO_005 309 CDS 100% 13.200 6.600 Y Pramef6 n/a
6 TRCN0000179667 GCACCTGATGAAGTCTATGAT pLKO.1 1285 CDS 100% 5.625 2.813 Y Pramel4 n/a
7 TRCN0000179124 GCAGGTCTCAAGAGATTCATT pLKO.1 1515 CDS 100% 5.625 2.813 Y Pramel4 n/a
8 TRCN0000202133 CCAAGCATCCATCAGCTCAAA pLKO.1 985 CDS 100% 4.950 2.475 Y Pramel4 n/a
9 TRCN0000192052 CCAGACAGATTTGTACAACTT pLKO.1 1324 CDS 100% 4.950 2.475 Y Pramel4 n/a
10 TRCN0000184209 GCTGTACTAGATGGCCTTGAT pLKO.1 253 CDS 100% 4.950 2.475 Y Pramel4 n/a
11 TRCN0000196167 GCATGGTATCTTCTGAGCCTT pLKO.1 1454 CDS 100% 2.640 1.320 Y Pramel4 n/a
12 TRCN0000201710 CCTGAAAGCTACAATGAGCTT pLKO.1 3 5UTR 100% 0.264 0.132 Y Pramel4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.