Transcript: Mouse XM_017319979.1

PREDICTED: Mus musculus Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (Smg7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smg7 (226517)
Length:
5652
CDS:
85..3375

Additional Resources:

NCBI RefSeq record:
XM_017319979.1
NBCI Gene record:
Smg7 (226517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219600 CTCCAACGCATAACCATAATT pLKO.1 3008 CDS 100% 15.000 21.000 N Smg7 n/a
2 TRCN0000193619 CCTACACTTTACAGTAGCGTA pLKO.1 4172 3UTR 100% 2.640 3.696 N Smg7 n/a
3 TRCN0000175062 GCCATTTGAGAAATCCTTATT pLKO.1 2694 CDS 100% 13.200 10.560 N Smg7 n/a
4 TRCN0000292285 GGGAATGAAGGCTCCATAAAC pLKO_005 3394 3UTR 100% 13.200 10.560 N SMG7 n/a
5 TRCN0000174613 GCTGTACGATTTCAAATTCAT pLKO.1 4141 3UTR 100% 5.625 3.938 N Smg7 n/a
6 TRCN0000193702 CAACACAGTTACAGCCAAGAT pLKO.1 1057 CDS 100% 4.950 3.465 N Smg7 n/a
7 TRCN0000146911 CACTTTCTAAAGCACTGGAAA pLKO.1 794 CDS 100% 4.950 3.465 N SMG7 n/a
8 TRCN0000173819 CCATAGTGAAGCCACAGTCTA pLKO.1 521 CDS 100% 4.950 3.465 N Smg7 n/a
9 TRCN0000173788 CCCGTGAAGATGATCTCTCAA pLKO.1 1310 CDS 100% 4.950 3.465 N Smg7 n/a
10 TRCN0000175747 GCAGTTGTTAATGCAGCAGAA pLKO.1 3309 CDS 100% 4.050 2.835 N Smg7 n/a
11 TRCN0000194071 GCTGTACCGTAGTCATTGTTT pLKO.1 4347 3UTR 100% 5.625 3.375 N Smg7 n/a
12 TRCN0000130588 CCTCCAATGGTCAGCCTTATA pLKO.1 656 CDS 100% 13.200 18.480 N SMG7 n/a
13 TRCN0000292265 CCTCCAATGGTCAGCCTTATA pLKO_005 656 CDS 100% 13.200 18.480 N SMG7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.