Transcript: Mouse XM_017320109.1

PREDICTED: Mus musculus transducin-like enhancer of split 1 (Tle1), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tle1 (21885)
Length:
5037
CDS:
1051..3351

Additional Resources:

NCBI RefSeq record:
XM_017320109.1
NBCI Gene record:
Tle1 (21885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236782 GATCTTCTCTTTGGGATATTG pLKO_005 3015 CDS 100% 13.200 10.560 N Tle1 n/a
2 TRCN0000257356 GAGTCTCTGGACCGGATTAAA pLKO_005 1144 CDS 100% 15.000 10.500 N Tle1 n/a
3 TRCN0000098008 GCAGTCTCACTTGGCAATAAA pLKO.1 1455 CDS 100% 15.000 10.500 N Tle1 n/a
4 TRCN0000255725 TACAGGCTCTTACACTATATT pLKO_005 4145 3UTR 100% 15.000 10.500 N Tle1 n/a
5 TRCN0000236781 GAGAGCCTGGCACGAGTAATT pLKO_005 1517 CDS 100% 13.200 9.240 N Tle1 n/a
6 TRCN0000098007 GCGCAGTATCACAGTCTTAAA pLKO.1 1186 CDS 100% 13.200 9.240 N Tle1 n/a
7 TRCN0000236783 GGCACAGATAAGCGCAGAAAT pLKO_005 1564 CDS 100% 13.200 9.240 N Tle1 n/a
8 TRCN0000098009 CGCAGAAATGGTCCAGAGTTT pLKO.1 1576 CDS 100% 4.950 3.465 N Tle1 n/a
9 TRCN0000098005 GCCAAATGTTTGGAATTTGTA pLKO.1 3386 3UTR 100% 0.563 0.394 N Tle1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01676 pDONR223 100% 79.9% 86.7% None (many diffs) n/a
2 ccsbBroad304_01676 pLX_304 0% 79.9% 86.7% V5 (many diffs) n/a
3 TRCN0000472033 GTTGAGTAGATATGCCCGAGGGGC pLX_317 20.6% 79.9% 86.7% V5 (many diffs) n/a
4 ccsbBroadEn_07072 pDONR223 100% 79.8% 86.7% None (many diffs) n/a
5 ccsbBroad304_07072 pLX_304 0% 79.8% 86.7% V5 (many diffs) n/a
6 TRCN0000470715 GCATCAGATGATGCAAGGCGTTCG pLX_317 14.3% 79.8% 86.7% V5 (many diffs) n/a
7 ccsbBroadEn_11192 pDONR223 100% 65.2% 69.6% None (many diffs) n/a
8 ccsbBroad304_11192 pLX_304 0% 65.2% 69.6% V5 (many diffs) n/a
Download CSV