Transcript: Mouse XM_017320185.1

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member C11 (Dnajc11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajc11 (230935)
Length:
4423
CDS:
2240..3196

Additional Resources:

NCBI RefSeq record:
XM_017320185.1
NBCI Gene record:
Dnajc11 (230935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439594 GAATCGACACAGACGGGTAAA pLKO_005 3177 CDS 100% 10.800 15.120 N Dnajc11 n/a
2 TRCN0000422121 GGGCACTGTATCAATTATGTG pLKO_005 3313 3UTR 100% 4.950 6.930 N Dnajc11 n/a
3 TRCN0000425292 TCCTTTGCACTCATCAGTTAT pLKO_005 2312 CDS 100% 13.200 9.240 N Dnajc11 n/a
4 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 1599 5UTR 100% 4.950 2.475 Y Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08574 pDONR223 100% 40.8% 44% None (many diffs) n/a
2 ccsbBroad304_08574 pLX_304 0% 40.8% 44% V5 (many diffs) n/a
3 TRCN0000465874 CCACTATTCTCGCAAAACGTTTTC pLX_317 21.8% 40.8% 44% V5 (many diffs) n/a
Download CSV