Transcript: Mouse XM_017320246.1

PREDICTED: Mus musculus pantothenate kinase 4 (Pank4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pank4 (269614)
Length:
2469
CDS:
1083..2237

Additional Resources:

NCBI RefSeq record:
XM_017320246.1
NBCI Gene record:
Pank4 (269614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362283 TGACCAAGTTGGCATACTATT pLKO_005 10 5UTR 100% 13.200 18.480 N Pank4 n/a
2 TRCN0000221747 CCCTCATAAATGTGCCTTAAT pLKO.1 1754 CDS 100% 13.200 9.240 N Pank4 n/a
3 TRCN0000362285 CTGTGTTCACACCGGAGTATT pLKO_005 2302 3UTR 100% 13.200 9.240 N Pank4 n/a
4 TRCN0000362284 CCTACCTCCTAGTCAACATTG pLKO_005 439 5UTR 100% 10.800 7.560 N Pank4 n/a
5 TRCN0000221749 CCCTACCTCCTAGTCAACATT pLKO.1 438 5UTR 100% 5.625 3.938 N Pank4 n/a
6 TRCN0000221751 CGCCTGCATTTCATCAAGTTT pLKO.1 144 5UTR 100% 5.625 3.938 N Pank4 n/a
7 TRCN0000221750 CGCACAATCACCTACAGCATT pLKO.1 876 5UTR 100% 4.950 3.465 N Pank4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03555 pDONR223 100% 42.1% 44.7% None (many diffs) n/a
2 ccsbBroad304_03555 pLX_304 0% 42.1% 44.7% V5 (many diffs) n/a
3 TRCN0000480786 CGGTTTGGCCTGTAAAGGACGACC pLX_317 18.1% 42.1% 44.7% V5 (many diffs) n/a
Download CSV