Transcript: Mouse XM_017320297.1

PREDICTED: Mus musculus predicted gene 13119 (Gm13119), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm13119 (433779)
Length:
1485
CDS:
1..1485

Additional Resources:

NCBI RefSeq record:
XM_017320297.1
NBCI Gene record:
Gm13119 (433779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272205 CCTCTCAGTTATGCCTTATAT pLKO_005 1409 CDS 100% 15.000 7.500 Y Gm13057 n/a
2 TRCN0000270173 TGCATTTGGCAGGTATCATTT pLKO_005 1025 CDS 100% 13.200 6.600 Y Pramef25 n/a
3 TRCN0000198804 CCAGCTGATCATGGAGCTTTA pLKO.1 1266 CDS 100% 10.800 5.400 Y Gm13119 n/a
4 TRCN0000281924 CTGGCAGACACACGAAGATAC pLKO_005 173 CDS 100% 10.800 5.400 Y Gm13057 n/a
5 TRCN0000284640 TACAGAGCCTGGCGAAGAATG pLKO_005 80 CDS 100% 10.800 5.400 Y Gm13040 n/a
6 TRCN0000176469 CCTTGGAATTAGAACATTGTA pLKO.1 1109 CDS 100% 5.625 2.813 Y Gm13119 n/a
7 TRCN0000178636 CCACGAGAAACTCTTCACTTT pLKO.1 762 CDS 100% 4.950 2.475 Y Gm13119 n/a
8 TRCN0000181264 CGAGGTCAACTTCTGTGACAA pLKO.1 1191 CDS 100% 4.950 2.475 Y Gm13119 n/a
9 TRCN0000177434 CGTAAACTCCATCTAACACTA pLKO.1 739 CDS 100% 4.950 2.475 Y Gm13119 n/a
10 TRCN0000270111 TTGCCATTGTTGCCAGTAAAT pLKO_005 1467 CDS 100% 13.200 6.600 Y Pramef25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.