Transcript: Mouse XM_017320326.1

PREDICTED: Mus musculus predicted gene 13043 (Gm13043), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm13043 (545693)
Length:
1491
CDS:
7..1491

Additional Resources:

NCBI RefSeq record:
XM_017320326.1
NBCI Gene record:
Gm13043 (545693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272205 CCTCTCAGTTATGCCTTATAT pLKO_005 1415 CDS 100% 15.000 7.500 Y Gm13057 n/a
2 TRCN0000281867 CGTCCCTGACATGACAATATT pLKO_005 258 CDS 100% 15.000 7.500 Y Gm13057 n/a
3 TRCN0000272202 TGCACTGAGGCGACGTTTAAA pLKO_005 468 CDS 100% 15.000 7.500 Y Gm13040 n/a
4 TRCN0000270416 ACGTCCCTGACATGACAATAT pLKO_005 257 CDS 100% 13.200 6.600 Y Gm13043 n/a
5 TRCN0000270113 ATGCACTGAGGCGACGTTTAA pLKO_005 467 CDS 100% 13.200 6.600 Y Pramef25 n/a
6 TRCN0000270463 GCAACACGCCCTCATAGTTAT pLKO_005 448 CDS 100% 13.200 6.600 Y Gm13043 n/a
7 TRCN0000284643 GTCTTGTGCCTCTCGGAATTT pLKO_005 1064 CDS 100% 13.200 6.600 Y Gm13040 n/a
8 TRCN0000272204 AGATCAAGAATCTTCGTAAAC pLKO_005 731 CDS 100% 10.800 5.400 Y Gm13040 n/a
9 TRCN0000272208 CAACACGCCCTCATAGTTATG pLKO_005 449 CDS 100% 10.800 5.400 Y Gm13057 n/a
10 TRCN0000270461 CAGATCAAGAATCTTCGTAAA pLKO_005 730 CDS 100% 10.800 5.400 Y Gm13043 n/a
11 TRCN0000198804 CCAGCTGATCATGGAGCTTTA pLKO.1 1272 CDS 100% 10.800 5.400 Y Gm13119 n/a
12 TRCN0000281924 CTGGCAGACACACGAAGATAC pLKO_005 179 CDS 100% 10.800 5.400 Y Gm13057 n/a
13 TRCN0000284640 TACAGAGCCTGGCGAAGAATG pLKO_005 86 CDS 100% 10.800 5.400 Y Gm13040 n/a
14 TRCN0000270462 TGAGGAGTTGGAATTGCATAT pLKO_005 663 CDS 100% 10.800 5.400 Y Gm13043 n/a
15 TRCN0000176469 CCTTGGAATTAGAACATTGTA pLKO.1 1115 CDS 100% 5.625 2.813 Y Gm13119 n/a
16 TRCN0000181386 CCAAGAAAGAGGAAGCTTCAA pLKO.1 328 CDS 100% 4.950 2.475 Y BC080695 n/a
17 TRCN0000178636 CCACGAGAAACTCTTCACTTT pLKO.1 768 CDS 100% 4.950 2.475 Y Gm13119 n/a
18 TRCN0000181264 CGAGGTCAACTTCTGTGACAA pLKO.1 1197 CDS 100% 4.950 2.475 Y Gm13119 n/a
19 TRCN0000177434 CGTAAACTCCATCTAACACTA pLKO.1 745 CDS 100% 4.950 2.475 Y Gm13119 n/a
20 TRCN0000181810 GCTTTCTTCTGAGCTCATGAA pLKO.1 1353 CDS 100% 4.950 2.475 Y BC080695 n/a
21 TRCN0000182741 CCAGAGAGAATTGTCCAGCTT pLKO.1 1336 CDS 100% 2.640 1.320 Y BC080695 n/a
22 TRCN0000200371 GTCCTAACGAACCTTCTGCAT pLKO.1 1234 CDS 100% 2.640 1.320 Y BC080695 n/a
23 TRCN0000270111 TTGCCATTGTTGCCAGTAAAT pLKO_005 1473 CDS 100% 13.200 6.600 Y Pramef25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.