Transcript: Mouse XM_017320583.1

PREDICTED: Mus musculus chondroitin polymerizing factor 2 (Chpf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chpf2 (100910)
Length:
6122
CDS:
2048..4354

Additional Resources:

NCBI RefSeq record:
XM_017320583.1
NBCI Gene record:
Chpf2 (100910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434908 TCATGTACCGGCTCCACAAAC pLKO_005 2985 CDS 100% 10.800 7.560 N CHPF2 n/a
2 TRCN0000040747 CGGTCACCATAGAGACGGGAT pLKO.1 713 5UTR 100% 0.720 0.360 Y Znrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12045 pDONR223 100% 76.3% 79.8% None (many diffs) n/a
2 ccsbBroad304_12045 pLX_304 0% 76.3% 79.8% V5 (many diffs) n/a
3 TRCN0000479345 GGCCCGGCTTGTCCAAAAACACTG pLX_317 21% 76.3% 79.8% V5 (many diffs) n/a
Download CSV