Transcript: Mouse XM_017320601.1

PREDICTED: Mus musculus argininosuccinate lyase (Asl), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asl (109900)
Length:
2563
CDS:
1798..2505

Additional Resources:

NCBI RefSeq record:
XM_017320601.1
NBCI Gene record:
Asl (109900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120118 GCAGATTCATCGTGAGAACAT pLKO.1 2169 CDS 100% 4.950 6.930 N Asl n/a
2 TRCN0000120119 GAAGTGTCTGACACCATGATA pLKO.1 2110 CDS 100% 5.625 3.938 N Asl n/a
3 TRCN0000120120 GCCACCAGTGAGAGAGACTTT pLKO.1 1804 CDS 100% 4.950 3.465 N Asl n/a
4 TRCN0000120121 CTGAAGGAACTCATCGGTGAA pLKO.1 80 5UTR 100% 4.050 2.835 N Asl n/a
5 TRCN0000120117 GCACCTTCAAATTACATCCTA pLKO.1 24 5UTR 100% 3.000 2.100 N Asl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05858 pDONR223 100% 44.2% 47.6% None (many diffs) n/a
2 ccsbBroad304_05858 pLX_304 0% 44.2% 47.6% V5 (many diffs) n/a
3 TRCN0000467542 ACTAACTGGAGAACACTGCCTGGG pLX_317 32.7% 44.2% 47.6% V5 (many diffs) n/a
Download CSV