Transcript: Mouse XM_017320729.1

PREDICTED: Mus musculus cytohesin 3 (Cyth3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyth3 (19159)
Length:
3816
CDS:
416..1471

Additional Resources:

NCBI RefSeq record:
XM_017320729.1
NBCI Gene record:
Cyth3 (19159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110120 GCTGTTTCAAACTTGGGTTAA pLKO.1 2350 3UTR 100% 10.800 15.120 N Cyth3 n/a
2 TRCN0000110124 CTGTCATTAGAAGAGCGAGAA pLKO.1 317 5UTR 100% 4.050 5.670 N Cyth3 n/a
3 TRCN0000110122 CGGAGATTGACAACCTGACTT pLKO.1 420 CDS 100% 4.950 3.960 N Cyth3 n/a
4 TRCN0000382324 GCCAATAAGAAATAGGTAAAT pLKO_005 1457 CDS 100% 13.200 9.240 N Cyth3 n/a
5 TRCN0000381071 CAGAAGTGATGACGGAGATTG pLKO_005 408 5UTR 100% 10.800 7.560 N Cyth3 n/a
6 TRCN0000110123 CCTGAAGACCTGTCATTAGAA pLKO.1 308 5UTR 100% 5.625 3.938 N Cyth3 n/a
7 TRCN0000110121 CCATCAAAGCAAGCATCAGTA pLKO.1 1392 CDS 100% 4.950 3.465 N Cyth3 n/a
8 TRCN0000179183 GATGACATTGAGAGGCTGAAA pLKO.1 377 5UTR 100% 4.950 2.970 N CYTH3 n/a
9 TRCN0000230432 CCATGAACCGAGGCATCAATG pLKO_005 930 CDS 100% 10.800 5.400 Y CYTH1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2529 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15663 pDONR223 0% 44.8% 50.9% None (many diffs) n/a
2 ccsbBroad304_15663 pLX_304 0% 44.8% 50.9% V5 (many diffs) n/a
3 TRCN0000467209 ATCGCCCAGGGTACGTTCCTAGCC pLX_317 8% 44.8% 50.9% V5 (many diffs) n/a
Download CSV