Transcript: Mouse XM_017320799.1

PREDICTED: Mus musculus coiled-coil domain containing 92 (Ccdc92), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc92 (215707)
Length:
1471
CDS:
363..932

Additional Resources:

NCBI RefSeq record:
XM_017320799.1
NBCI Gene record:
Ccdc92 (215707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216038 CTGATTGTGTGTTCATAATTT pLKO.1 1393 3UTR 100% 15.000 21.000 N Ccdc92 n/a
2 TRCN0000200366 GATAAGCCACACAAGACGCAT pLKO.1 780 CDS 100% 2.640 3.696 N Ccdc92 n/a
3 TRCN0000197752 GATCTAACATATGAGCTGACA pLKO.1 86 5UTR 100% 0.000 0.000 N Ccdc92 n/a
4 TRCN0000177564 CTAGAATATGAATCGCCTGAA pLKO.1 1205 3UTR 100% 4.050 3.240 N Ccdc92 n/a
5 TRCN0000197565 CACTGCACAGATCTAACATAT pLKO.1 77 5UTR 100% 13.200 9.240 N Ccdc92 n/a
6 TRCN0000200181 CTGAAGGTGAAGAGCCACAAA pLKO.1 336 5UTR 100% 4.950 3.465 N Ccdc92 n/a
7 TRCN0000182408 GAAGAGCCACAAACTGAGCAT pLKO.1 344 5UTR 100% 2.640 1.848 N Ccdc92 n/a
8 TRCN0000177565 CACAGATCTAACATATGAGCT pLKO.1 82 5UTR 100% 0.000 0.000 N Ccdc92 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04190 pDONR223 100% 46% 50.9% None (many diffs) n/a
2 ccsbBroad304_04190 pLX_304 0% 46% 50.9% V5 (many diffs) n/a
3 TRCN0000471853 ACACTAAGATACTGTAGAAAGGCC pLX_317 34.6% 46% 50.9% V5 (many diffs) n/a
Download CSV