Transcript: Mouse XM_017321012.1

PREDICTED: Mus musculus ATP-binding cassette, sub-family B (MDR/TAP), member 9 (Abcb9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcb9 (56325)
Length:
4178
CDS:
1735..3372

Additional Resources:

NCBI RefSeq record:
XM_017321012.1
NBCI Gene record:
Abcb9 (56325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433104 AGCTCATTGGCCGCAGGTATT pLKO_005 1786 CDS 100% 10.800 15.120 N Abcb9 n/a
2 TRCN0000110854 CCGTGTATTGTTGGATGGCAA pLKO.1 2754 CDS 100% 2.640 2.112 N Abcb9 n/a
3 TRCN0000110851 GCCTTCATCATCTACGAATTT pLKO.1 2410 CDS 100% 13.200 9.240 N Abcb9 n/a
4 TRCN0000110853 CCAGGTCAGTATTCTCTACTA pLKO.1 2340 CDS 100% 4.950 3.465 N Abcb9 n/a
5 TRCN0000110850 CCCTTCTACTGTGTCCTTCTT pLKO.1 3488 3UTR 100% 4.950 3.465 N Abcb9 n/a
6 TRCN0000110852 CCTCGTATTTGCCAGACTGAA pLKO.1 1824 CDS 100% 4.950 3.465 N Abcb9 n/a
7 TRCN0000432590 GCAAGCTCACTAAGATGTTTC pLKO_005 3637 3UTR 100% 10.800 6.480 N Abcb9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11737 pDONR223 100% 44.7% 45.6% None (many diffs) n/a
2 ccsbBroad304_11737 pLX_304 0% 44.7% 45.6% V5 (many diffs) n/a
3 TRCN0000468050 TGATTGCTCCTTTTCCACACCAGA pLX_317 21.7% 44.7% 45.6% V5 (many diffs) n/a
Download CSV