Transcript: Mouse XM_017321043.1

PREDICTED: Mus musculus general transcription factor II I repeat domain-containing 1 (Gtf2ird1), transcript variant X22, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gtf2ird1 (57080)
Length:
3304
CDS:
210..3137

Additional Resources:

NCBI RefSeq record:
XM_017321043.1
NBCI Gene record:
Gtf2ird1 (57080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218294 ATGCTGTTCAACACGAAATAT pLKO_005 1920 CDS 100% 15.000 12.000 N Gtf2ird1 n/a
2 TRCN0000226280 CCCTCAGAGGATTCCGGTTAT pLKO_005 1788 CDS 100% 10.800 8.640 N Gtf2ird1 n/a
3 TRCN0000081794 CGTCCATGACAAGTCAGAGAA pLKO.1 1199 CDS 100% 4.950 3.960 N Gtf2ird1 n/a
4 TRCN0000226281 GTGAAGCTCTGGGCATCAAAT pLKO_005 2416 CDS 100% 13.200 9.240 N Gtf2ird1 n/a
5 TRCN0000226282 ACCCAGGCTCGGTAATCATTG pLKO_005 2473 CDS 100% 10.800 7.560 N Gtf2ird1 n/a
6 TRCN0000226279 CCAGAAGCAGGACACCCTAAA pLKO_005 495 CDS 100% 10.800 7.560 N Gtf2ird1 n/a
7 TRCN0000081793 GCTGTGGAAATTGTGGGTATT pLKO.1 1365 CDS 100% 10.800 7.560 N Gtf2ird1 n/a
8 TRCN0000081796 GTGCCCTACAAGAGAATCAAA pLKO.1 2448 CDS 100% 5.625 3.938 N Gtf2ird1 n/a
9 TRCN0000081797 CCAGTGTACATGGTGGACTAT pLKO.1 3075 CDS 100% 4.950 3.465 N Gtf2ird1 n/a
10 TRCN0000081795 GAGATGCTGTTCAACACGAAA pLKO.1 1917 CDS 100% 4.950 3.465 N Gtf2ird1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.