Transcript: Mouse XM_017321090.1

PREDICTED: Mus musculus lysine (K)-specific methyltransferase 2E (Kmt2e), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kmt2e (69188)
Length:
7766
CDS:
1770..6995

Additional Resources:

NCBI RefSeq record:
XM_017321090.1
NBCI Gene record:
Kmt2e (69188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241165 GCAACTTCTGGAGCGTTATTT pLKO_005 5940 CDS 100% 15.000 21.000 N Kmt2e n/a
2 TRCN0000230227 GCCCTATGCGGACCATAATTA pLKO_005 1946 CDS 100% 15.000 21.000 N KMT2E n/a
3 TRCN0000241163 GCCCTATGCGGACCATAATTA pLKO_005 1946 CDS 100% 15.000 21.000 N Kmt2e n/a
4 TRCN0000241164 ACTCCAACTTCAATCACTTTA pLKO_005 2394 CDS 100% 13.200 9.240 N Kmt2e n/a
5 TRCN0000241162 AGCCAGCTGTAGGTATCTTTA pLKO_005 7210 3UTR 100% 13.200 9.240 N Kmt2e n/a
6 TRCN0000358562 CTCCTGTAGAGAGCCATATAC pLKO_005 2758 CDS 100% 13.200 9.240 N KMT2E n/a
7 TRCN0000157609 GCCCTGTGGTAGTTGAGAAAT pLKO.1 1861 CDS 100% 13.200 9.240 N KMT2E n/a
8 TRCN0000241161 ATGCAGTGTTTGGCAACATAT pLKO_005 2180 CDS 100% 13.200 7.920 N Kmt2e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14213 pDONR223 100% 31.1% 31% None (many diffs) n/a
2 ccsbBroad304_14213 pLX_304 0% 31.1% 31% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474830 GTTGGTTTATGTTGACGAATCGTC pLX_317 23.5% 31.1% 31% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV