Transcript: Mouse XM_017321187.1

PREDICTED: Mus musculus actin-like 6B (Actl6b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Actl6b (83766)
Length:
1268
CDS:
176..1072

Additional Resources:

NCBI RefSeq record:
XM_017321187.1
NBCI Gene record:
Actl6b (83766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116767 CCTGGCATAACTACATGTGTA pLKO.1 504 CDS 100% 4.950 3.960 N ACTL6B n/a
2 TRCN0000090284 ACAGACTTAATCGGGAGCTTT pLKO.1 867 CDS 100% 4.950 3.465 N Actl6b n/a
3 TRCN0000090287 AGCATCGGCATGTGTGACATT pLKO.1 752 CDS 100% 4.950 3.465 N Actl6b n/a
4 TRCN0000090286 CTGGCATAACTACATGTGTAA pLKO.1 505 CDS 100% 4.950 3.465 N Actl6b n/a
5 TRCN0000090283 GCAGTACAACATTCCTGCCTT pLKO.1 184 CDS 100% 2.640 1.848 N Actl6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03302 pDONR223 100% 60.5% 66.8% None (many diffs) n/a
2 ccsbBroad304_03302 pLX_304 0% 60.5% 66.8% V5 (many diffs) n/a
3 TRCN0000478329 ATCGTGTAATAAACAACTTGGTCA pLX_317 25.4% 60.5% 66.8% V5 (many diffs) n/a
Download CSV