Transcript: Mouse XM_017321249.1

PREDICTED: Mus musculus abl-interactor 2 (Abi2), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abi2 (329165)
Length:
7116
CDS:
806..2086

Additional Resources:

NCBI RefSeq record:
XM_017321249.1
NBCI Gene record:
Abi2 (329165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088032 GAGTCTTCAATCAACCATATT pLKO.1 1064 CDS 100% 13.200 18.480 N Abi2 n/a
2 TRCN0000088031 GCCAGTTCGTTATATTCGAAA pLKO.1 1201 CDS 100% 4.950 6.930 N Abi2 n/a
3 TRCN0000088029 CCTCCTTCCATAACGTCACAA pLKO.1 1577 CDS 100% 4.950 3.465 N Abi2 n/a
4 TRCN0000088028 GCCTACAGTAATCGGAGACTT pLKO.1 4419 3UTR 100% 4.950 3.465 N Abi2 n/a
5 TRCN0000088030 GTCACAAACAAGCCTTCAGAA pLKO.1 1591 CDS 100% 4.950 3.465 N Abi2 n/a
6 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 3750 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
7 TRCN0000298633 GTCAGGTCTTCCCAGATTATC pLKO_005 2117 3UTR 100% 13.200 9.240 N ABI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02333 pDONR223 100% 83.7% 89% None (many diffs) n/a
2 ccsbBroad304_02333 pLX_304 0% 83.7% 89% V5 (many diffs) n/a
3 TRCN0000468963 CATCACGGCCGAGAGATTGTAAAG pLX_317 27.8% 83.7% 89% V5 (many diffs) n/a
Download CSV