Transcript: Mouse XM_017321278.1

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 12B (Ppp1r12b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r12b (329251)
Length:
4400
CDS:
182..2944

Additional Resources:

NCBI RefSeq record:
XM_017321278.1
NBCI Gene record:
Ppp1r12b (329251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077154 CGGCATTAACTTCTGGACAAA pLKO.1 2770 CDS 100% 4.950 6.930 N Ppp1r12b n/a
2 TRCN0000077155 CCAGCCATGAAAGACCTTCTT pLKO.1 680 CDS 100% 4.950 3.465 N Ppp1r12b n/a
3 TRCN0000077156 CGCCTAAGGTATCCAACTCAA pLKO.1 2504 CDS 100% 4.950 3.465 N Ppp1r12b n/a
4 TRCN0000077157 GCTGACTCAACAGCAGAGAAA pLKO.1 2048 CDS 100% 4.950 3.465 N Ppp1r12b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10985 pDONR223 100% 14.3% 14.7% None (many diffs) n/a
2 ccsbBroad304_10985 pLX_304 0% 14.3% 14.7% V5 (many diffs) n/a
3 TRCN0000472803 TTCCCCCCTTCGGTTTGAAAACGC pLX_317 80.9% 14.3% 14.7% V5 (many diffs) n/a
Download CSV