Transcript: Mouse XM_017321283.1

PREDICTED: Mus musculus family with sequence similarity 163, member A (Fam163a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam163a (329274)
Length:
4212
CDS:
765..1271

Additional Resources:

NCBI RefSeq record:
XM_017321283.1
NBCI Gene record:
Fam163a (329274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177494 GCTAGTTTACACTCTGTTATT pLKO.1 1773 3UTR 100% 13.200 18.480 N Fam163a n/a
2 TRCN0000198160 CTAATCCAAGGGCTATTAGTA pLKO.1 1240 CDS 100% 0.563 0.788 N Fam163a n/a
3 TRCN0000200303 GCGCTATATGACACCTTCCAA pLKO.1 1537 3UTR 100% 3.000 2.400 N Fam163a n/a
4 TRCN0000197654 CCATCTATGATGTGACATTAT pLKO.1 2378 3UTR 100% 13.200 9.240 N Fam163a n/a
5 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 898 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05018 pDONR223 100% 87.6% 84.6% None (many diffs) n/a
2 ccsbBroad304_05018 pLX_304 0% 87.6% 84.6% V5 (many diffs) n/a
3 TRCN0000475177 GTCCGCCCCTCGCGGCGCAATAAG pLX_317 74% 87.6% 84.6% V5 (many diffs) n/a
Download CSV