Transcript: Mouse XM_017321381.1

PREDICTED: Mus musculus polyhomeotic-like 1 (Drosophila) (Phc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phc1 (13619)
Length:
3867
CDS:
31..3111

Additional Resources:

NCBI RefSeq record:
XM_017321381.1
NBCI Gene record:
Phc1 (13619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321173 CAACCTAATGCGGCTCAATAT pLKO_005 214 CDS 100% 13.200 18.480 N Phc1 n/a
2 TRCN0000012559 GCAACCTAATGCGGCTCAATA pLKO.1 213 CDS 100% 13.200 18.480 N Phc1 n/a
3 TRCN0000273069 AGCTCATCCTGATGCCTAATG pLKO_005 599 CDS 100% 10.800 15.120 N Phc1 n/a
4 TRCN0000012561 GCTTATTAGCTCAGCCACATA pLKO.1 1170 CDS 100% 4.950 6.930 N Phc1 n/a
5 TRCN0000273068 GCTTATTAGCTCAGCCACATA pLKO_005 1170 CDS 100% 4.950 6.930 N Phc1 n/a
6 TRCN0000012562 CCTCCAAACAGTGATCTAGTA pLKO.1 2173 CDS 100% 4.950 3.960 N Phc1 n/a
7 TRCN0000273005 GCCTGGCTGTTCAGGTTATAA pLKO_005 3146 3UTR 100% 15.000 10.500 N Phc1 n/a
8 TRCN0000273067 CACCTGAACCAACCTCTAAAC pLKO_005 1547 CDS 100% 10.800 7.560 N Phc1 n/a
9 TRCN0000012560 CCAGAGTTACAGGGCATCAAT pLKO.1 2863 CDS 100% 5.625 3.938 N Phc1 n/a
10 TRCN0000012558 CCTTCTCACTATTCACACCTA pLKO.1 3291 3UTR 100% 2.640 1.848 N Phc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10796 pDONR223 100% 38.2% 38.8% None (many diffs) n/a
2 ccsbBroad304_10796 pLX_304 0% 38.2% 38.8% V5 (many diffs) n/a
3 TRCN0000469712 GATGAGGCAGACTAGATACACGCT pLX_317 32.1% 38.2% 38.8% V5 (many diffs) n/a
Download CSV