Transcript: Mouse XM_017321596.1

PREDICTED: Mus musculus sphingosine-1-phosphate phosphotase 2 (Sgpp2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgpp2 (433323)
Length:
3944
CDS:
295..1110

Additional Resources:

NCBI RefSeq record:
XM_017321596.1
NBCI Gene record:
Sgpp2 (433323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080801 CCGTTCCTCTTGTGCTACAAT pLKO.1 679 CDS 100% 5.625 7.875 N Sgpp2 n/a
2 TRCN0000080800 CCCTGCAAGTATTATTCTCAT pLKO.1 947 CDS 100% 4.950 3.960 N Sgpp2 n/a
3 TRCN0000051787 GAAGTGTTCTACATCACGTTT pLKO.1 205 5UTR 100% 4.950 3.960 N SGPP2 n/a
4 TRCN0000080799 CCCTAATTTGTCCAGAAGATT pLKO.1 252 5UTR 100% 5.625 3.938 N Sgpp2 n/a
5 TRCN0000080802 AGATTGGTTGTGATATGGGTT pLKO.1 268 5UTR 100% 2.640 1.848 N Sgpp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09526 pDONR223 100% 58.8% 62.1% None (many diffs) n/a
2 ccsbBroad304_09526 pLX_304 0% 58.8% 62.1% V5 (many diffs) n/a
3 TRCN0000481653 GCCGAATATTACTCTCAGTAGGGC pLX_317 32.8% 58.8% 62.1% V5 (many diffs) n/a
Download CSV