Transcript: Mouse XM_017321966.1

PREDICTED: Mus musculus double C2, alpha (Doc2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Doc2a (13446)
Length:
2336
CDS:
450..1667

Additional Resources:

NCBI RefSeq record:
XM_017321966.1
NBCI Gene record:
Doc2a (13446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197546 CCACTCGTTTAAATAACTGTT pLKO.1 2182 3UTR 100% 4.950 6.930 N Doc2a n/a
2 TRCN0000217065 CCCTTATGTGAAGACGTACTT pLKO.1 1328 CDS 100% 4.950 6.930 N Doc2a n/a
3 TRCN0000200437 GACTTCATAGGTGGTGTGTCT pLKO.1 1512 CDS 100% 2.640 2.112 N Doc2a n/a
4 TRCN0000200143 CCTGGCTGCAATGGATGTTAA pLKO.1 1295 CDS 100% 13.200 9.240 N Doc2a n/a
5 TRCN0000182185 CCTCAAGCCCATGGATTTCAA pLKO.1 809 CDS 100% 5.625 3.938 N Doc2a n/a
6 TRCN0000182128 CTCAGGATCTCTGTCTGTGAT pLKO.1 987 CDS 100% 4.950 3.465 N Doc2a n/a
7 TRCN0000177152 GATAAGAAATCCAAGCACAAA pLKO.1 1362 CDS 100% 4.950 3.465 N Doc2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07241 pDONR223 100% 86.5% 93.8% None (many diffs) n/a
2 ccsbBroad304_07241 pLX_304 0% 86.5% 93.8% V5 (many diffs) n/a
3 TRCN0000465365 GTCTTCGCCATCGCGTTCTGGAAC pLX_317 26.8% 86.5% 93.8% V5 (many diffs) n/a
Download CSV