Transcript: Mouse XM_017322086.1

PREDICTED: Mus musculus SWA-70 protein (Swap70), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Swap70 (20947)
Length:
4807
CDS:
1655..2638

Additional Resources:

NCBI RefSeq record:
XM_017322086.1
NBCI Gene record:
Swap70 (20947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100105 GCCTTCATACAGTTTAGATTT pLKO.1 3812 3UTR 100% 13.200 9.240 N Swap70 n/a
2 TRCN0000055575 GCCTGACAAAGATGGAAAGAA pLKO.1 1675 CDS 100% 5.625 3.938 N SWAP70 n/a
3 TRCN0000291334 GCCTGACAAAGATGGAAAGAA pLKO_005 1675 CDS 100% 5.625 3.938 N SWAP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02719 pDONR223 100% 48.9% 52.2% None (many diffs) n/a
2 ccsbBroad304_02719 pLX_304 0% 48.9% 52.2% V5 (many diffs) n/a
3 TRCN0000466687 CAACGATCGAGTTGTAACGAAGGG pLX_317 17.2% 48.9% 52.2% V5 (many diffs) n/a
Download CSV