Transcript: Mouse XM_017322173.1

PREDICTED: Mus musculus vacuolar protein sorting 33B (Vps33b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps33b (233405)
Length:
1632
CDS:
353..1531

Additional Resources:

NCBI RefSeq record:
XM_017322173.1
NBCI Gene record:
Vps33b (233405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328519 CGAATTGCTAACGTCTCTATC pLKO_005 503 CDS 100% 10.800 15.120 N Vps33b n/a
2 TRCN0000093310 CGCAATGAGCACTTCTCCAAT pLKO.1 1220 CDS 100% 4.950 3.960 N Vps33b n/a
3 TRCN0000380900 AGCATGGAACTGCCAGAATTT pLKO_005 812 CDS 100% 13.200 9.240 N Vps33b n/a
4 TRCN0000328575 CCGGAGAGGCATGGACATAAA pLKO_005 1294 CDS 100% 13.200 9.240 N Vps33b n/a
5 TRCN0000328517 CGGAACTTGCAGGCCCAATAT pLKO_005 1268 CDS 100% 13.200 9.240 N Vps33b n/a
6 TRCN0000328518 TTGAGGAAGAGGGAGTCTATG pLKO_005 732 CDS 100% 10.800 7.560 N Vps33b n/a
7 TRCN0000380629 AGATGTGCAAAGATGTCATAT pLKO_005 944 CDS 100% 13.200 7.920 N Vps33b n/a
8 TRCN0000093313 CCAGAGATTGGACACATCTTT pLKO.1 1019 CDS 100% 5.625 3.375 N Vps33b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08011 pDONR223 100% 58% 61.5% None (many diffs) n/a
2 ccsbBroad304_08011 pLX_304 0% 58% 61.5% V5 (many diffs) n/a
3 TRCN0000475288 CGTTACGATGTCGAATTTACTGGT pLX_317 13.6% 58% 61.5% V5 (many diffs) n/a
Download CSV